FC877901

Overview
NameFC877901
Unique NameFC877901
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length967
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC877901_ssr75 microsatellite FC877901_ssr75:75..88. BLAST: Citrus ESTs to Populus V2 proteins
Ccv1_Contig12982 contig Ccv1_Contig12982:20..992. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA49BE08RM1 IVIA1 Citrus clementina cDNA clone IC0AAA49BE08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877901 ID=FC877901|Name=FC877901|organism=Citrus clementina|type=EST|length=967bp
CTATTTAAGCTAGCTGCTCCTTTACTCTGCCATTCAAGGTCTACTATTTT
TGCATCTCAAACTTGAGGAGGTGGGTGTGTGTGTGTGTAGAAGTCAATTT
TGGTTTTGCTTAAAATGAAACATCTTTGTCTAATTATGTAATAATATCTT
ATATTTTGAGTTACATAATTATAGGATATATCATCAATTTTCTTGTTCAG
GGATTTCTATTACCACCACAAGAAGCCATAATCAAGAAAGCAAAGAGATG
TTGCTAAGAAGCTCCTCGACACCAGTTCTAGGTTCTCTCCTTTCTCCAAT
CCAAGAGGGTCCCAGCAGCAACCATGAAACCAACGCCACCTTCAAGCACC
ACCTGCCACCACCGTCACCGACCACCACCATTCACCACAGCCACAGCTAC
AACAAACTCTCGTGTGCGGCCTTTAATATTCCTACAGTCTCCTGCCATTC
CTCTCCCAGGTCGTCTCCCTCTGCCGCCGACCACAAAGGCATTCGCCGGG
CGCAATCCGAAGGGAACTTGGCAGGCCTAGCTCATGCTTCTTGCAAGGAT
GAGGAGGAACATCTCTATAATGCAAACCAACCCAACAGCAATAAGAGGGT
TTTAGGGAGATACAAATGCTCGGTGTTGAAATCAATACCATCTTTTTCGT
CCGTGGATGAAGATGATGAGGAGTTGTTGCAGAATATAAGACGAGGAGGA
GGGGGAGAGACGGTCACGGCCGCGGGAGGTGGTGAATTTAGATTGAACAA
TGGAATGGCGGGCACGGCGCTTAGTGAGGAGGTGAAAGTCATGGAAGCAC
TTTGGAATGTTGGTTTTGAAGAGGAAAGAGGGACAGTTGGTCAAGAGATG
TACCTGGCAAAGGGACTTGGCGTTGGTGGCAGAGGTGGCGGTCGAGGTGG
CAGAGGAGGAGGAACTGGAGGTGGAGGCGGCGGGTTTTATCCACCAGGCT
CCGGTGGGGACACCCAA
back to top