FC877904

Overview
NameFC877904
Unique NameFC877904
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length930
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11065 contig Ccv1_Contig11065:2..905. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: PIGA_MOUSE (N-acetylglucosaminyl-phosphatidylinositol biosynthetic protein OS=Mus musculus GN=Piga PE=2 SV=1)

HSP 1 Score: 275.018 bits (702), Expect = 4.196e-73
Identity = 129/223 (57.85%), Postives = 166/223 (74.44%), Query Frame = 3
Query:  261 HRILMVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKPAPERLGSNEIIIVLYSRLVYRKGADFAL*VIPEVCRCY 929
            H I MVSDFFYPN GGVE+HIY LSQCL++ GHKV+ +THAYGNR GVRY+T GLKVYY+P R    Q+T  T + +LP++R I +RE+I+++H H +FS + H+AL HA+TMG + VFTDHSL+GFADV S+  NK+L  +L D +  ICVS+TSKENTVLR+ L P+ V V+PNAVD   F P P R   + I +V+ SRLVYRKG D    +IPE+C+ Y
Sbjct:   33 HNICMVSDFFYPNMGGVESHIYQLSQCLIERGHKVITVTHAYGNRKGVRYLTNGLKVYYLPLRVMYNQSTATTLFHSLPLLRYIFVRERITIIHSHSSFSAMAHDALFHAKTMGLQTVFTDHSLFGFADVSSVLTNKLLTVSLCDTNHIICVSYTSKENTVLRAALNPEIVSVIPNAVDPTDFTPDPFRRHDSVITVVVVSRLVYRKGTDLLSGIIPELCQKY 255          
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: PIGA_HUMAN (Phosphatidylinositol N-acetylglucosaminyltransferase subunit A OS=Homo sapiens GN=PIGA PE=1 SV=1)

HSP 1 Score: 270.781 bits (691), Expect = 7.913e-72
Identity = 127/223 (56.95%), Postives = 167/223 (74.89%), Query Frame = 3
Query:  261 HRILMVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKPAPERLGSNEIIIVLYSRLVYRKGADFAL*VIPEVCRCY 929
            H I MVSDFFYPN GGVE+HIY LSQCL++ GHKV+++THAYGNR G+RY+T GLKVYY+P +    Q+T  T + +LP++R I +RE+++++H H +FS + H+AL HA+TMG + VFTDHSL+GFADV S+  NK+L  +L D +  ICVS+TSKENTVLR+ L P+ V V+PNAVD   F P P R   + I IV+ SRLVYRKG D    +IPE+C+ Y
Sbjct:   33 HNICMVSDFFYPNMGGVESHIYQLSQCLIERGHKVIIVTHAYGNRKGIRYLTSGLKVYYLPLKVMYNQSTATTLFHSLPLLRYIFVRERVTIIHSHSSFSAMAHDALFHAKTMGLQTVFTDHSLFGFADVSSVLTNKLLTVSLCDTNHIICVSYTSKENTVLRAALNPEIVSVIPNAVDPTDFTPDPFR-RHDSITIVVVSRLVYRKGIDLLSGIIPELCQKY 254          
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: GPI3_SCHPO (Phosphatidylinositol N-acetylglucosaminyltransferase gpi3 subunit OS=Schizosaccharomyces pombe GN=gpi3 PE=2 SV=1)

HSP 1 Score: 254.988 bits (650), Expect = 4.493e-67
Identity = 119/216 (55.09%), Postives = 157/216 (72.69%), Query Frame = 3
Query:  273 MVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKPAPERLGSNEIIIVLYSRLVYRKGADFAL*VIPEVC 920
            MVSDFF+P  GG+E+HI+ LSQ L+  GHKV+V+THAY +R GVRY+T GL VYYVP      + T P+F+   PI R I+IRE I +VHGH + S LCH+A++HARTMG +  FTDHSL+GFAD GSI  NK+L+FT++DV+  ICVSHT +ENTVLR+ L P++V V+PNA+    F+P P +   + + IV+ SRL Y KG D  + VIP +C
Sbjct:    1 MVSDFFFPQPGGIESHIFQLSQRLIDLGHKVIVITHAYKDRVGVRYLTNGLTVYYVPLHTVYRETTFPSFFSFFPIFRNIVIRENIEIVHGHGSLSFLCHDAILHARTMGLKTCFTDHSLFGFADAGSIVTNKLLKFTMSDVNHVICVSHTCRENTVLRAVLNPKRVSVIPNALVAENFQPDPSKASKDFLTIVVISRLYYNKGIDLLIAVIPRIC 216          
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: GPI3_YEAST (Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit OS=Saccharomyces cerevisiae GN=SPT14 PE=1 SV=4)

HSP 1 Score: 231.491 bits (589), Expect = 5.320e-60
Identity = 114/224 (50.89%), Postives = 154/224 (68.75%), Query Frame = 3
Query:  267 ILMVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKPAPERLGS------NEIIIVLYSRLVYRKGADFAL*VIPEVC 920
            I M+ DFFYP  GGVE HIY+LSQ L+  GH VV++THAY +R GVR++T GLKVY+VP+     + T PT + T PIIR IL+RE+I +VH H + ST  HE ++HA TMG R VFTDHSLYGF ++ SI +NK+L FTL ++ + ICVS+T KEN ++R+ L P  + V+PNAV +  FKP     G+      ++I+IV+  RL   KG+D    +IP+VC
Sbjct:    5 IAMLCDFFYPQLGGVEFHIYHLSQKLIDLGHSVVIITHAYKDRVGVRHLTNGLKVYHVPFFVIFRETTFPTVFSTFPIIRNILLREQIQIVHSHGSASTFAHEGILHANTMGLRTVFTDHSLYGFNNLTSIWVNKLLTFTLTNIDRVICVSNTCKENMIVRTELSPDIISVIPNAVVSEDFKPRDPTGGTKRKQSRDKIVIVVIGRLFPNKGSDLLTRIIPKVC 228          
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: GPI3_YEAS6 (Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit OS=Saccharomyces cerevisiae (strain AWRI1631) GN=SPT14 PE=3 SV=2)

HSP 1 Score: 231.491 bits (589), Expect = 5.320e-60
Identity = 114/224 (50.89%), Postives = 154/224 (68.75%), Query Frame = 3
Query:  267 ILMVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKPAPERLGS------NEIIIVLYSRLVYRKGADFAL*VIPEVC 920
            I M+ DFFYP  GGVE HIY+LSQ L+  GH VV++THAY +R GVR++T GLKVY+VP+     + T PT + T PIIR IL+RE+I +VH H + ST  HE ++HA TMG R VFTDHSLYGF ++ SI +NK+L FTL ++ + ICVS+T KEN ++R+ L P  + V+PNAV +  FKP     G+      ++I+IV+  RL   KG+D    +IP+VC
Sbjct:    5 IAMLCDFFYPQLGGVEFHIYHLSQKLIDLGHSVVIITHAYKDRVGVRHLTNGLKVYHVPFFVIFRETTFPTVFSTFPIIRNILLREQIQIVHSHGSASTFAHEGILHANTMGLRTVFTDHSLYGFNNLTSIWVNKLLTFTLTNIDRVICVSNTCKENMIVRTELSPDIISVIPNAVVSEDFKPRDPTGGTKRKQSRDKIVIVVIGRLFPNKGSDLLTRIIPKVC 228          
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: GPI3_YEAS1 (Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit OS=Saccharomyces cerevisiae (strain RM11-1a) GN=SPT14 PE=3 SV=1)

HSP 1 Score: 231.491 bits (589), Expect = 5.320e-60
Identity = 114/224 (50.89%), Postives = 154/224 (68.75%), Query Frame = 3
Query:  267 ILMVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKPAPERLGS------NEIIIVLYSRLVYRKGADFAL*VIPEVC 920
            I M+ DFFYP  GGVE HIY+LSQ L+  GH VV++THAY +R GVR++T GLKVY+VP+     + T PT + T PIIR IL+RE+I +VH H + ST  HE ++HA TMG R VFTDHSLYGF ++ SI +NK+L FTL ++ + ICVS+T KEN ++R+ L P  + V+PNAV +  FKP     G+      ++I+IV+  RL   KG+D    +IP+VC
Sbjct:    5 IAMLCDFFYPQLGGVEFHIYHLSQKLIDLGHSVVIITHAYKDRVGVRHLTNGLKVYHVPFFVIFRETTFPTVFSTFPIIRNILLREQIQIVHSHGSASTFAHEGILHANTMGLRTVFTDHSLYGFNNLTSIWVNKLLTFTLTNIDRVICVSNTCKENMIVRTELSPDIISVIPNAVVSEDFKPRDPTGGTKRKQSRDKIVIVVIGRLFPNKGSDLLTRIIPKVC 228          
BLAST of FC877904 vs. ExPASy Swiss-Prot
Match: GPI3_YEAS7 (Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit OS=Saccharomyces cerevisiae (strain YJM789) GN=SPT14 PE=3 SV=1)

HSP 1 Score: 231.106 bits (588), Expect = 6.949e-60
Identity = 113/224 (50.45%), Postives = 153/224 (68.30%), Query Frame = 3
Query:  267 ILMVSDFFYPNFGGVENHIYYLSQCLLKFGHKVVVMTHAYGNRSGVRYMTGGLKVYYVPWRPFIMQNTLPTFYGTLPIIRTILIREKISLVHGHQAFSTLCHEALMHARTMGYRVVFTDHSLYGFADVGSIHMNKVLQFTLADVSQAICVSHTSKENTVLRSGLPPQKVFVVPNAVDTAMFKP------APERLGSNEIIIVLYSRLVYRKGADFAL*VIPEVC 920
            I M+ DFFYP  GGVE HIY+LSQ L+  GH VV++THAY +R GVR++T GLKVY+VP+     + T PT + T PIIR IL+RE+I +VH H + ST  HE ++HA TMG R VFTDHSLYGF ++ SI +NK+L FTL ++ + ICVS+T KEN ++R+ L P  + V+PNAV +  FKP         +   ++I+IV+  RL   KG+D    +IP+VC
Sbjct:    5 IAMLCDFFYPQLGGVEFHIYHLSQKLIDLGHSVVIITHAYKDRVGVRHLTNGLKVYHVPFFVIFRETTFPTVFSTFPIIRNILLREQIQIVHSHGSASTFAHEGILHANTMGLRTVFTDHSLYGFNNLTSIWVNKLLTFTLTNIDRVICVSNTCKENMIVRTELSPDIISVIPNAVVSEDFKPRDPTDSTKRKQSRDKIVIVVIGRLFPNKGSDLLTRIIPKVC 228          
The following BLAST results are available for this feature:
BLAST of FC877904 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 7
Match NameE-valueIdentityDescription
PIGA_MOUSE4.196e-7357.85N-acetylglucosaminyl-phosphatidylinositol biosynth... [more]
PIGA_HUMAN7.913e-7256.95Phosphatidylinositol N-acetylglucosaminyltransfera... [more]
GPI3_SCHPO4.493e-6755.09Phosphatidylinositol N-acetylglucosaminyltransfera... [more]
GPI3_YEAST5.320e-6050.89Phosphatidylinositol N-acetylglucosaminyltransfera... [more]
GPI3_YEAS65.320e-6050.89Phosphatidylinositol N-acetylglucosaminyltransfera... [more]
GPI3_YEAS15.320e-6050.89Phosphatidylinositol N-acetylglucosaminyltransfera... [more]
GPI3_YEAS76.949e-6050.45Phosphatidylinositol N-acetylglucosaminyltransfera... [more]
back to top
Properties
Property NameValue
Genbank descriptionIC0AAA15CA10RM1 IVIA1 Citrus clementina cDNA clone IC0AAA15CA10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877904 ID=FC877904|Name=FC877904|organism=Citrus clementina|type=EST|length=930bp
CGCCAGTTCCATTTTCAAGTTTTCCACCGCCGTCACTCGTCAGCCACACC
GTTAGTCTAGCGGCAGGCAGCCGCCGCAGCAGAACGTCGCCTTCGCCTTA
GCCAGCCCGTCGCCTCCAATCTCGGGCCGGTCGCCGGAAATTTTGTTCCA
ATGAGAGGAGGTCTTAATTCATGGAATCTTACTGCAATTTGATGCTGGGC
TGGTATGATTCCTGATTCATCCCATTCAGTGAGAGATTTGGATTCATGGC
TAATCAGAAGCATAGAATTCTGATGGTCTCTGATTTTTTCTATCCCAACT
TTGGTGGTGTGGAGAATCACATATACTATTTGTCACAATGCCTGCTAAAG
TTTGGCCACAAGGTGGTGGTCATGACTCATGCTTATGGAAATCGTTCTGG
TGTGAGATACATGACTGGCGGCTTGAAAGTTTACTATGTACCATGGAGAC
CATTTATTATGCAGAATACACTGCCGACCTTCTATGGGACACTTCCAATT
ATAAGGACAATCCTTATTCGGGAAAAAATATCATTGGTGCATGGGCATCA
AGCCTTCTCAACTCTTTGTCACGAAGCTCTGATGCACGCTCGCACGATGG
GATATAGAGTTGTGTTTACTGACCATTCTCTTTATGGTTTTGCCGATGTT
GGGAGCATCCACATGAACAAAGTATTGCAGTTTACTTTGGCAGATGTGAG
CCAGGCCATTTGTGTTTCGCACACAAGCAAAGAAAATACGGTGCTACGAT
CAGGCCTGCCACCCCAAAAGGTTTTTGTAGTACCAAATGCCGTGGACACT
GCTATGTTCAAACCTGCCCCAGAGCGTCTCGGTAGTAATGAAATTATTAT
TGTTTTGTATAGCAGATTAGTTTATCGCAAGGGTGCAGACTTTGCTTTGT
GAGTCATTCCTGAGGTCTGCCGATGTTATC
back to top