FC920173

Overview
NameFC920173
Unique NameFC920173
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length438
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14424 contig Ccv1_Contig14424:162..600. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32005A01EF RVDevelop1 Citrus clementina cDNA clone C32005A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920173 ID=FC920173|Name=FC920173|organism=Citrus clementina|type=EST|length=438bp
TTGTTTCGTCACTCTTTCTCTTCTCATGTGTCATCTCTCTGTCGCTAGTC
AAAATGCCGACATCAAATTGCCACTCAGAGCTGTGAATCTTGGAAACTGG
CTTGTCACTGAAGGATGGATGAAACCTTCTCGCTTTGATGATATTCCCAA
CAAGGATCTTCTGGATGGAACTCAAGTTCAGTTCATGTCAACAAAGTTTC
AGAAGTATATTGCCGCTGAAAGCGCAGGTGGCACCATTGTTGTAGCCAAC
ACAACCTCACCTTCTGGCTGGGAAACTTTCAGGTTGTGGAGGGACAATCA
GACATTTTACAATTTCAGAGTGAACAATAAGCAGTTTATTGGACTGGAGA
ATCAAGGCCAAGGAAATGTTCTAGGAGCAGTTTCCAATACAGCTGGTTAC
TCCGAGACATTTCAGATTGTGAGGAAAGATGGCGATTC
back to top