FC920183

Overview
NameFC920183
Unique NameFC920183
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length564
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32005A11EF RVDevelop1 Citrus clementina cDNA clone C32005A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920183 ID=FC920183|Name=FC920183|organism=Citrus clementina|type=EST|length=564bp
TGCGAGTCGTAAGTCTTTGAACTGCAATGGGTGGCTGCCTCTTGATGTTG
CTAGGATGTGGGGGCGCCATTGGCTCGAACCATTGCTGGCACCCAGTTCT
GATGCTGTTATGCCAAGATTTCATCCTTCCAATTACTTATCCTTGCCTCT
TTTGAGTGTACTTAATGTAGCCAGAGAGTGTGGGTTGCTGTCTTCAACAA
CCTCTTCTTCAGATGATGCTGATACATGTGCTGTCTGTCTGGAGCGAGCA
TGTACAGTTGCTGCTGAAGGGTGTAGGCACGAGCTTTGTGTAAGATGTGC
ACTGTACCTCTGCTCAACAAATAATATTCCTTCTGAGATGGTTGGTCCGC
CTGGCTCCATTCCATGCCCTCTCTGTAGACATGGCATTGTCTCTTTCACC
AAATTGCCTGGCTCCCCGGTAAAAGATATTAAGCAACCTCTGTCCCTTGG
CCTTTGTACCCCATGCATGCTTCACACTCGTGATGCTGAGTGTGAATCTC
CAGCATGTGCCCCAGAGATTCGGAAGAATCGTGTAGCTTTGGTTTCCTCA
GATATGTTGTGCCC
back to top