FC920384

Overview
NameFC920384
Unique NameFC920384
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length741
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC920384_ssr253 microsatellite FC920384_ssr253:253..262. BLAST: Citrus ESTs to Prunus persica proteins V1
FC920384_ssr130 microsatellite FC920384_ssr130:130..144. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32007F06EF RVDevelop1 Citrus clementina cDNA clone C32007F06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920384 ID=FC920384|Name=FC920384|organism=Citrus clementina|type=EST|length=741bp
GCGAAAGGAAGCGTTTCGCCGGCAAGCGAAAAAAAGCCAAAAGCATGGAC
TTTACGATTCACCACCAGTCGAGCAATTCTCCTTCGTCATCCTCCACCTC
TTCCTCCACTCCCCACCCAAATCCAATTACCGCCGCCGCCGCCGATCAAG
ATCCAGTCCATTCTTGGTGGGAATCCGTCTCCAAAGCAAGGTCTCGAATC
CTCACGTTATCCTCGATTATCTCCTCTTCCTCTCCCTCTCCCTCTACATC
ATTCTCTCTCTCTTCTCTCGCTGATTCTGATCGTCCTGCCCTTTCTCTCC
TCTCTTCACCTGATGCCTACTCCCTGCTTTCCTCTTTACTTTCCTGTCCT
TCCTCCGGCTCTGGCTCTGATCCTCTCTGCCAGTGGCTGTACGACACCTA
CATTTTATCCGATTCCAATCTCCGTCTTATTGTTCTCTCTTTTCTTCCCT
TACTCTCCGCGATTTATCTCGCTCGTGTCCATTCCAACGAAACCTCCTCA
ATTCCTTCACTCTCCGGATTCGAGGCCGTGATTCTTGCAATCTACAGCTC
TGAAGCCAAATCCCGTGCTGGCAAACCCCTCTTAGTTCAAATCCCTGACC
TATCTCAGCCTTCACTCTACCACTCCCCTCGTATTCCAATTATGGAGAAA
CAATCTAGGCCGTCGGTTGGAGTTCTGTCGGCCCCACTGGAGCCACACAT
TGCTGTAGTCAACCAGCGAGCCTCATTTCTGGACAGCTTTG
back to top