FC924888

Overview
NameFC924888
Unique NameFC924888
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length702
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9350 contig Ccv1_Contig9350:52..753. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP6YM16FM1 TF Citrus clementina cDNA clone KN0AAP6YM16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC924888 ID=FC924888|Name=FC924888|organism=Citrus clementina|type=EST|length=702bp
CGACCTTTGGAGCTTGGAGTGGGTGTGGGTGGATATTGGCGCTTCATTCC
ATGGCCGTCGTTACAAATTTCATTTTAAAACTCCCTTTGTCTCTCTCAGC
AAACCCTAAATTTACTCCTCTACGTTCCCCTCATTCTCTTTTTTCACCGC
CTATTTTCGCCAAACCTCAGTCTTTAACAAAACCGAAAACTAGCAGAACC
CAGTTATTGATAACAAAGGCCACAGCTGCCCCAGGAACAAAGAATGCTCC
AAGGGATGAAAGAGTAAAGAAAGTCCACAGTATTGAAGAATTCGACGAAG
CCCTAAGATTGGCGAAAAACAAACTCGTTGTGGTTGAATTTGCTGCTAGC
CGCAGTCTCGACAGCAGCAAAATCTACCCTTTTATGGTTGACCTGAGCAG
GCAATGCAACGACGTCGAATTCATTCTTGTGATGGGCGATGAGTCTGAAA
AAACAAAAGAACTCTGCGAAAGAGAGAAGATAAAAAAGGTTCCCCACTTC
AGCTTTTACAAAAGCATGGAGAAAATTCATGAAGAAGAAGGAATAGGCCC
CGATCAGCTCATGGGGGATGTGTTATATTACGGTGACAGTCATTCTGCTG
TGGTGCAGCTTCACTCCAAAGAGGATGTTGAGAAGCTGATTGATGATCAT
AAGGTTGATCAGAAGCTGATTGTTCTTGATGTGGGGTTGAAGCATTTGTG
GG
back to top