FC924891

Overview
NameFC924891
Unique NameFC924891
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length632
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7813 contig Ccv1_Contig7813:372..1003. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP6YM18FM1 TF Citrus clementina cDNA clone KN0AAP6YM18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC924891 ID=FC924891|Name=FC924891|organism=Citrus clementina|type=EST|length=632bp
CTCTGCAGCTCGCTCGACGCACGCTCTCTGAAACCCCTGGTTCGTTATAA
CAAAAGTGACTTCCATTTCTCCCAATCCCTTGTACTTGAGAAACTCCCCA
CTCATTTCAACACCAAACTCGCGCTCAAACCCTCGAAGTGTTGCATCAAA
ACCAGCTCAGCGTCGGCGTCCATTGATATCGACATGGTGAGAAACAAGCA
AGGAATCTACACGCAAAAACAGAACAACAAAGTGGTGGTTCTGTGGGACC
TCGATAACAAACCCCCGCGGGGCCCGCCTTACGACGCCGCCATGTCGCTG
AGACGAGTGGCGGAGAGGTTCGGGGAAGTCACGGACATCTCGGCTTACGC
CAACCGGCATGCGTTCATTCACCTGCCTCAGTGGGTCATCCAGGAACGCC
GCGAGCGCAAGCAATTCGACATTCTCGAGCGCAGAGGAGTGGCGGTTCCA
AATGATCCGTACATTTGCGGGGTGTGCGGACGCAAGTGTAAAACCAATCT
TGATCTGAAGAAACACTTTAAGCAGTTACATGAACGCGAGCGGCAAAAGA
AGCTGAATCGGATGAAATCCTTGAAGGGTAAAAAGAGGCAGAAGTACAAA
GAGAGGTATATAAGTGGGAATGACAAGTATAA
back to top