FC924893

Overview
NameFC924893
Unique NameFC924893
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig3644 contig Ccv1_Contig3644:1..722. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP6YM19FM1 TF Citrus clementina cDNA clone KN0AAP6YM19, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC924893 ID=FC924893|Name=FC924893|organism=Citrus clementina|type=EST|length=722bp
CTGCTTAGTCAGTTTTTCACTCGATACAATATGCAAAAACCTTCATCAGC
TTCAATCTCAAATCTTTCTCACTGCAAGCGTGTATCTCTCTAAAACCCAG
TATTTTAACAAGGTCAATGCATGGAGGGATTGCCAAGTGCATTTAAAAGT
GACTGATGCAATTACTTTTGCAATGACATGCTATCATTCCACAAGATCAA
AATGGGATATTAGCACAAAGTAATCAATATACATATCTTTTTTTTTTAGA
ATGGGGACAATCCAAAAGGTTTTGGATAGCACCATAAGAACTGCGCCATA
GTTCAAGACAAGAGAATCCATCAACTAAATGGAATACTTTTTTCTTGAAT
TTTCTATTCTCAATTCAAATCAGTGTCATGAGAAGTGAAGCAAAAGCCTG
AAGGAAGAGCATACGTGTTCACCGTTAAACATGAAGGCTAAGGGCTGTTT
TTGACCGTATGCTGGTCTTGCACATCTGATTATTATAAATTTTGAGAGAG
TGCAAACATGACCGAAATATCAAAGCATGTTAGAAGATTTAGAAAGAGCA
TCAAGCATGCAACCCTCATTCGATGGATGAAATAATGGGATATGAGGTGT
GGGTGTTAAGTTATTAGATATGTGCTGGTTTTGAGATGGAATATGATATT
ATTCTCCCTGGATTTGGGGTGGACCATTGAGGAAAGCAATACTGTATGTC
GACAAGTGACGTCTAAAAATGT
back to top