FC928873

Overview
NameFC928873
Unique NameFC928873
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length364
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13437 contig Ccv1_Contig13437:935..1298. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1CC04RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CC04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928873 ID=FC928873|Name=FC928873|organism=Citrus clementina|type=EST|length=364bp
GACATTCCAAGACTGCCAAAAGACACCCAACCTGGGTTATTGAGGACCAA
GGATGGAGCCAAAAAGCTAATGGACTTGGGTTTACAATTCATTCCCATGG
ATCAAATCATCAAGGACTCTGTCGAGAGTTTGAAGGCCAAAGGATTTATC
TCTTGAATGAAAGCTGCAACGTGTCAGCAGCTGCTGATGAACCCATCCGC
TTTATACAAGCAGAGGGCTGAGAGCTATAGTATAATTAGATAATTTGGTT
AAATGTTGTCTCTTTGTAATTTTCTGTGAAATATCGTTGAGATGAGCCAC
TGTCAGGAAGTCGACAACTTAATAAATAAAATATCTTTCTAGAAAAAAAA
AAAAAAAAAAAAAA
back to top