FC928878

Overview
NameFC928878
Unique NameFC928878
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length656
Alignments
Feature NameTypeLocationAnalysis
FC928878_ssr16 microsatellite FC928878_ssr16:16..27.
FC928878_ssr62 microsatellite FC928878_ssr62:62..76.
FC928878_ssr138 microsatellite FC928878_ssr138:138..158.
Ccv1_Contig531 contig Ccv1_Contig531:205..860. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1CC09RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CC09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928878 ID=FC928878|Name=FC928878|organism=Citrus clementina|type=EST|length=656bp
GGCACGAGGGAGCAGGCAGCAGCAGCAGTTGAAATATCATCATCGCAACA
GGACCAGCAAGAGCAGCAGCAGCAGCCACAAGTTGATGTTAAGCCTCCGA
GATCAGTCAACACTACCATTGAAAGAAGCCGATCCAACGGCGGCGGCGGC
GGCGGCGGCGCTGGAGCAAGAGGGTACCGCACCGGCAGAGTCTCTCCGGC
AATCGAACCTCCTTCTCCTAGGGTTTCTGCATGTGGGTTCTGCAGCGCTT
TTGCTAATAAACCCCCCAAGAATAACACTCATGCCAAGAGAACCGGTAAG
CGTAGATCACGACCGTTCTAGATATCACATGTTCTGAGGCCACCACCGGA
AGTGGAATATTCCGATGAGCTTGGGAATATTGTTTATTATTGTTTGTGCA
TTTATAGGTTGGCAGGGTTTTGCAGTTCGGTTCGGTTAAATCCAGTTTAG
TTTATCTCACGAACAGAAGTGAGATGTAGGGAGTTTTGAAACAAGAACGA
TAGTGTTATTTTTTAAATTTTAACTTTTGCCTTTTAGATCATGGATTTTT
TGTTCTGTTTTTATGTTCTTGTGGTTCTGATGGGATGTAATTATGTAAAT
ATTGTTTGTTTCTCGAGAAATTCTCATCTTTGTACATAGAAAAAAAAAAA
AAAAAA
back to top