FC929005

Overview
NameFC929005
Unique NameFC929005
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length841
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC929005_ssr571 microsatellite FC929005_ssr571:571..582. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig8912 contig Ccv1_Contig8912:7..847. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH3BH01RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3BH01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929005 ID=FC929005|Name=FC929005|organism=Citrus clementina|type=EST|length=841bp
AATAGCGAGTTCTTTCGAACACAACAAAGCACTCGCCGTCACAGCAACCG
GATATACTCGGTCAGCTCAACGAAAAATCAATGCACTTTCTTATCTACTC
CGTCATATAAATTTGTTGCCAGGCTCCCCTCGATTCTCCATTCGCCTCTT
CATCGTTCAAATCTTCTAAGCTTTTTGCCCTGGTGTTTAGTGTGTATTTA
CGACTGTACCACCCGACTTATATGTTAGCTTCCGGTGACTGGGAACCTGA
GAGCCTCAGCTCCTCTCCAGCTCTCGGTTTCCCCCGCCTCTGGTTCTTCC
GTTACCGCCGCTTGAGATAACAGGTTAAAGCAAAATCAAGAACTAAATAG
AATTTTCATCAGCTTTTTTTTTTATTACAATAAGGTTATTTGCATATTTG
ATGCCGAATACTAAGAGTCACCGGAGAGGAGTACAGGAATCGAGCCGGAG
AGCAAGGTTATCGGAGAAATCGTCGTCGTTTCACGGGGGAATCCCGGCCA
CTATGCAGACGGATCAGAAGGAGCTCAGAAGGCCGAAGACTTTACCGGAT
TTGCTTCAAGATCGTAGCTTTGTCTGTCTGTCACCGGAATCGAGGCCGAA
GAAGCTGACGAAGCTGTTGTTGAACGTCACGGTTCAAGGAAGCGTCGGTG
CATTACACGTGATAATGTCGCCGGAAAATACCGTCGCCGATCTTGCTGCC
GCCGCCGTCAAGCAGTACATCAAAGAATGCCGCCGGCCGATCTTGCCGAC
CACCGATCCCTCCGGCTTCGACCTCCATTACTCTCAGTTTTGCTTGGAAA
GTTTGGGGAGAGAGGAGAAACTGATGGAGTTGGGGTCCAGG
back to top