FC929493

Overview
NameFC929493
Unique NameFC929493
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length828
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9291 contig Ccv1_Contig9291:2..829. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH2CG07RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2CG07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929493 ID=FC929493|Name=FC929493|organism=Citrus clementina|type=EST|length=828bp
ACAAAAGCAAAGACGTTATGGTCTTGTGGAGAATTGAGTAGTGATCAGTG
GGTAAAGTGGCGCCGGCGGTAACTTCTGGTTTCGGCGGTGGTGATCGGTG
AAATTGGAAGGCAGAAGAGTTGTAATTTTCTTTCAATTTTAGTTTAGAAG
TTACAATCTTACCCTTTTTTGTTAGGCTCTCTTAATTAAGTCTAAGTTCA
CTGTATGTAAAAGATTCATGGCTTCAGCTCCCTCAAAGCTCTACTCAGAT
GATGTTAGCCTTGTGGTCGTGTTACTAGACACAAACCCCTTCTTCTGGAG
CTCTTCTTCTTTATCCTTCTCTCAATTTCTCACTCATGTAAGCCCTAATT
TTCTCTATTTTTTTTTTATTTTCTTAAACTAATTCAACTATTTTTAGTTA
CTATTTAATTATTTATTTCATTGTAAGTTCATTGTAATTATTTAATTTTA
ACAGGTTCTTGCGTTTTTGAATGCAATATTGACTCTAAATCAGCTTAACC
AAGTTGTGGTTATTGCCACTGGGTATAATTCGTGTGACTATGTCTATGAT
TCGTCCTCAACGGGCAATCAGAGTGTTGGAAATGGTAGAATGCCCTCTTT
ATGTGCGACTTTGTTGCAAAATTTGGAGGAGTTTATGAATAAAGATGAGC
AACTTGGTAAACAAGAGCCAGAGGGGAGGATTGCTTGTTCCTTGTTGTCG
GGCTCCTTATCCATGGCTCTTTGTTGTATCCTTTGTTGATTTGTTCGTGT
GTTCAGTTGTGGGAGCTGAATGGCTTTATTGTATGTTATGTACCACTTGT
TTTTGCCATAGTTTTTAAAATGGGTCAT
back to top