FC929501

Overview
NameFC929501
Unique NameFC929501
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length853
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15046 contig Ccv1_Contig15046:1..853. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH2CH04RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2CH04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929501 ID=FC929501|Name=FC929501|organism=Citrus clementina|type=EST|length=853bp
GAGAGATGAGGCAATTGGGTAAGACGCTGAATAATCTTTCTTCAACACTC
TGTAATTTTGCTTTTCTTCTTTTTTCTTTTTTTTTTTAGTTTCTGAATAT
GAAATCTTAATTTGGTGCAGAAAAGCATTGCCTATAGCCATTGCAGTTGC
AGCTGTGGCACTTGCTGGTCTATACTTTTACCTAAACAGTGCTTTCTAGG
ATTCATAACAGCAACTCTCCCTCTTTGTGGGGAGAACAGCATTGCTCTTG
TAATTCTATTTCATTCATGGGTTTCCTATTCACTTGCACTACACTTCTTT
TGCGCCCATACCACATTGCAAGAGTTGAACTCCTCTTTTTCATTTAAAAT
AAAGCACTCAATGATATCTATTATGACATGCCAAAAATTTGCATTTCCTC
TATGGATTTCCTCCGCGAAGCAAATGTAAAAAATTGTAAATACATCACAT
CAACTTTAATTTCCCTATAATACAACTCATGCAGATTACATGATCGAAAA
CCCTCCTCCAAACTGTGTTTATTAGGTCACTACACTTGCTTCCAAATTCT
ATGGTGAATAATGGATCCGACGGTGCCCTACCAGACACCTATTTCTCCGG
TGCAAGCTGATTAGTGGTTGAGATATTACTCGGCCAAGATCAGCATGACA
AAGTTGATAGAGAACAGAAAGGGATTTCTTGTTTAATTTACCAGATAAGT
GAAAGTTGTAAATTTACATACTTTAGTTACATGTACCGAGTTATCATTCT
TGCAAGACAAAGGATCCTTCAATTCTCTTCTCAAAGAACTGCTGTGGAGG
GAAATTCAAGGGGGAGAACATGTCACTATAACTAGAACTAGGCGCCGGCT
TGA
back to top