FC929534

Overview
NameFC929534
Unique NameFC929534
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length380
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig8840 contig Ccv1_Contig8840:513..892. BLAST: Citrus Unigene V1 Contigs to SwissProt
Homology
BLAST of FC929534 vs. ExPASy Swiss-Prot
Match: YCF68_SACOF (Uncharacterized protein ycf68 OS=Saccharum officinarum GN=ycf68-1 PE=3 SV=1)

HSP 1 Score: 46.2098 bits (108), Expect = 2.368e-11
Identity = 20/21 (95.24%), Postives = 21/21 (100.00%), Query Frame = -3
Query:  289 KMEHLTTYLHRPRTTRSPLSF 351
            KMEHLTT+LHRPRTTRSPLSF
Sbjct:   80 KMEHLTTHLHRPRTTRSPLSF 100          

HSP 2 Score: 43.8986 bits (102), Expect = 2.368e-11
Identity = 20/23 (86.96%), Postives = 20/23 (86.96%), Query Frame = -1
Query:  177 FFHAFPGGLEKAAINRIFLILPS 245
            FFHAFPGGLEKA INR  LILPS
Sbjct:  112 FFHAFPGGLEKAVINRTSLILPS 134          
BLAST of FC929534 vs. ExPASy Swiss-Prot
Match: YCF68_SACHY (Uncharacterized protein ycf68 OS=Saccharum hybrid GN=ycf68-1 PE=3 SV=1)

HSP 1 Score: 46.2098 bits (108), Expect = 2.368e-11
Identity = 20/21 (95.24%), Postives = 21/21 (100.00%), Query Frame = -3
Query:  289 KMEHLTTYLHRPRTTRSPLSF 351
            KMEHLTT+LHRPRTTRSPLSF
Sbjct:   80 KMEHLTTHLHRPRTTRSPLSF 100          

HSP 2 Score: 43.8986 bits (102), Expect = 2.368e-11
Identity = 20/23 (86.96%), Postives = 20/23 (86.96%), Query Frame = -1
Query:  177 FFHAFPGGLEKAAINRIFLILPS 245
            FFHAFPGGLEKA INR  LILPS
Sbjct:  112 FFHAFPGGLEKAVINRTSLILPS 134          
BLAST of FC929534 vs. ExPASy Swiss-Prot
Match: YCF68_MAIZE (Uncharacterized protein ycf68 OS=Zea mays GN=ycf68 PE=3 SV=2)

HSP 1 Score: 46.2098 bits (108), Expect = 2.368e-11
Identity = 20/21 (95.24%), Postives = 21/21 (100.00%), Query Frame = -3
Query:  289 KMEHLTTYLHRPRTTRSPLSF 351
            KMEHLTT+LHRPRTTRSPLSF
Sbjct:   80 KMEHLTTHLHRPRTTRSPLSF 100          

HSP 2 Score: 43.8986 bits (102), Expect = 2.368e-11
Identity = 20/23 (86.96%), Postives = 20/23 (86.96%), Query Frame = -1
Query:  177 FFHAFPGGLEKAAINRIFLILPS 245
            FFHAFPGGLEKA INR  LILPS
Sbjct:  112 FFHAFPGGLEKAVINRTSLILPS 134          
The following BLAST results are available for this feature:
BLAST of FC929534 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 3
Match NameE-valueIdentityDescription
YCF68_SACOF2.368e-1195.24Uncharacterized protein ycf68 OS=Saccharum officin... [more]
YCF68_SACHY2.368e-1195.24Uncharacterized protein ycf68 OS=Saccharum hybrid ... [more]
YCF68_MAIZE2.368e-1195.24Uncharacterized protein ycf68 OS=Zea mays GN=ycf68... [more]
back to top
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AC06RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AC06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929534 ID=FC929534|Name=FC929534|organism=Citrus clementina|type=EST|length=380bp
GAGATAGATAAATAGACACATCCCATTGCACCGCTCGGGGGCGTTCGTAG
TGACTGAGGGGGTCGAAGACCAAGAAGTGAGTTATTTATCAGCCAAGCAT
TCTTCTTACGGCTAGATCCAATCTCCTGGTCCCTGCGGAAAGGAAAAGGA
AAAAGAATTTCACGTTCTTCCTTTCGGGAAGGGAGGATTAGGAAAATCCT
ATTGATTGCAGCTTTCTCCAGACCTCCGGGAAAAGCATGAAAAAAAAAAA
AGGCTCGAATGGTACGATCCCTCCGTCACCCCAGAATGAAATGAAAGGGG
CGATCTCGTAGTTCTTGGTCTGTGAAGATACGTTGTTAGGTGCTCCATTT
TTTTTCCCATTGAGGCCGAACCTAAACCTG
back to top