FC929537

Overview
NameFC929537
Unique NameFC929537
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length521
Alignments
Feature NameTypeLocationAnalysis
FC929537_ssr270 microsatellite FC929537_ssr270:270..281.
Ccv1_Contig15008 contig Ccv1_Contig15008:1..520. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AC09RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AC09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929537 ID=FC929537|Name=FC929537|organism=Citrus clementina|type=EST|length=521bp
AAACTCTTAACAATGAGTTACCATCCTGTTCCTCATGATTCTCCTTGTCC
CCCTCCAGGGCAACCACCGTCACCATATCCTCCACAGCCAGACTTTCCAC
CCCCACAGCCGCCAGTGGGGCAGCCATTTCCTCCACCACCCCCACCTGCC
TATGAGGGATACTTCAATGAAATGTACCCTCCACCACCACCGGCTCCACA
GCCTTCGCAGGACGATCACCAAAATGACACTGGATGCTGATCATGCCTGA
AGGGATGTTTGGATGCACTCTGCTGCTGCTGTGTATTGGAGGAATTGTGC
TTCTATGCCTTGCATGATTCTTCTCACTGGTTTATATGTGTGTTTTTTGT
TACTTTTACTGGGATATTTCAGACAATTATGAACGACAGTAGAAAATAGT
ATTTACACATCCTTTAGGGACGCCAAAATGTTAAAATCAAACTTGTGTTG
TTACAAACTGTCAATTTGAACTGTTGTAGATTTGCATCTGTTAAAAAAAA
AAAAAAAAAAAAAAAAAAAAA
back to top