FC929540

Overview
NameFC929540
Unique NameFC929540
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length420
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9944 contig Ccv1_Contig9944:15..434. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AC12RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AC12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929540 ID=FC929540|Name=FC929540|organism=Citrus clementina|type=EST|length=420bp
GCAGCTTAACTACTCTCGAACTTTGATTCCCGTAAGCAGAGATCTTTGTG
ATTTGAAGAACATGGAAACTACCTGCGCAGGTAATAACTGGTCAGAGGGT
TTTCTCATTCCACCGGCCAGTATTGCTGATGATGATGTCATGAACGATAA
TCTTGATCTTCTTAATATCCCTCAGTATGGAAGAAATCCCGACTACATGG
GTTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAA
ATGATAGGTATACGATTACCTATCAGTCATGGCCATGTCTTAATCTGGTT
TACTTCAACTTATAACATTTCTTGAGATGTACAAAATATCTTTTTGAGCT
AAGTATTTTCTTGAAAAAGGAAATAAATCAATAAAATTTATTGTGTGTGT
CAAAAAAGAAAAAAAAAAAA
back to top