FC929860

Overview
NameFC929860
Unique NameFC929860
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length691
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC929860_ssr378 microsatellite FC929860_ssr378:378..392. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig380 contig Ccv1_Contig380:3..693. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34001B12EF PostHarvC1 Citrus clementina cDNA clone C34001B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929860 ID=FC929860|Name=FC929860|organism=Citrus clementina|type=EST|length=691bp
GGCATGGGATCAATTTTGAGTCAACGATGAGTGCTTTAACGAAGCTAACA
AAAACACTTGCACATCACTGCGTCAAAAAATCTAAAACCCATTGGTGCAA
ACCTTCGCAGCCACTTTTAAATTTATTAATCTCTGAAAATATTGTTAACA
TCAACACTTCTCGGTTTCATCAGTACCAAAGCCGTAGAACTCTCATTCTA
GATTCCGCTTCCTCCGAATCGGTCCAGCTTCATGGGTGGCTTGAAGCTGT
ATATTTTGTGGTAGCCTAATTTTTATCATTGTCATCAACTATTATATTTC
ATTAATTTAACATCGGCCGCCGCTGACGTTGTATTGTTTATTTGTTTCAG
TTTCATAATTTAGATTTAAACTTAACAATTATTATTATTATTTGTTCTTC
CGTAAAAACTCGAACACCTGTGTCCTGACGGCTGGCGTTCGCTTCCAGCC
ATTTATATATAAAGACGGGGTATTTTTGTCAGACCGATAATATTTCCGCA
GAAATAAAAGCTAAAGAGAAAGCACAATGGCAGCAGTAGACGAGCGTCCT
TCAGCTAAGAGGTGGCTTCCTCTTGAAGCTAATCCCGATATCATGAACCA
GTTCCTTTGTGGCCTTGGTCTTCCAGCTGAGGAGGCAGAGTGCTATGATG
TGTATGGCTTGGATGATGAGCTCTTGGCAATGGTTCCGCAA
back to top