FC930891

Overview
NameFC930891
Unique NameFC930891
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length696
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15231 contig Ccv1_Contig15231:1..696. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110B07EF PostHarvP1 Citrus clementina cDNA clone C34110B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930891 ID=FC930891|Name=FC930891|organism=Citrus clementina|type=EST|length=696bp
GATAGCCATTCTAGTTTATATAAAGACAAAGAAACAATGACAGCTAGCAT
AGGGGTATTACATGGAAAAATTAAAATCGATTCGTGAGAATGGTAATCAT
GAACCAATCATATTAAGCTTCTATAAGGTTCAGCTACTGCAAATCAGAGT
AGCTTAAGTGGCATGCCCGCTTGGCTTCAAGGTCCATCTTTGACCTTTCA
CAGCTGCTGTTTTTAACACCAACCTCATCAGACCAGGGGAATACCGTTTT
TAGACATCATAAAAGTAGTACAGTTGCGCCGATTCGTCTAGCTCAAGTCA
AATTGTTTTGGTTTTATCGATCCGATCCTGAATCATGTCGCTGAGCATCA
AACAAGATCGGTACGCGTTCATTAAAAAGTCCAGCAAATTCATCGACTCC
TCAAACATCAGCACGCCGTGGGAGTATGATGGAGACAAGATCGTGTGCAA
GGTGTCTCTTCCGGCGGCGAAGATGGAGGATGTCAAAATTGATATTAACG
ATAAGAAGCTTACGATAACCACTGAGCTGAATATTACGGACGGAGGCACG
ATTAGCAGGCAGATTTTCTACAGGACTTTCGATTTGCCGGACGGTGTGAA
GCGGTCTAACTTCAAGAGTATTTCGATTGAGGATGGGGTCCTCACTGTCG
CTTTTACTAGAGATGCCGCCGCCCGCCGCAATACGTCCTCTGGCTC
back to top