FC930895

Overview
NameFC930895
Unique NameFC930895
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length660
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15232 contig Ccv1_Contig15232:1..660. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110B11EF PostHarvP1 Citrus clementina cDNA clone C34110B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930895 ID=FC930895|Name=FC930895|organism=Citrus clementina|type=EST|length=660bp
GAAGGGCTCTCATTTCTTCAAACACCAACCACTCAATAGCGGTTATGTAC
TCGGAGGCGATCGGGGAAAGCTCGGGTCGGATTTTGGCCACGAGGCCTTC
CGGGTCGGCCCAGTTAATAATCACGGTTTGATATCTGTTGGCGAGAGCGA
TGGTGTGCATGTCCAACGCGCAGAGAAGGTTAGGGTCGTTCACCAGCCAG
CCTTCCTTGCCCGCGCCGAGGTCGCTGAGATCCGTGCAGGCGATGGACCC
CACCTCCGTCGTGTGCGTACGTTTTGACATTTTTTGGTATCGTTTTGATT
GGGCTCCACCGTTTCCCGTTTACGCCATATGGATGGATCGGAGAAAGAGT
ACGAGCAAAGTTAACCACTAAGAGAAGTTTGAGGAATTAAATAGAGCTAC
CATGATCTCCTCCAAGTGAAAGTGAGCAAATGGTTGAGCAAACCACCTCG
ACCATGTACTATGAGGTTGAGCAGATCACCTTGACCAGGTGGTATGAGCT
TGAGCTGATGACCATGTGGTATGAGCTTGAGCAGATCACCTCGACCAGGT
GGTATGAGCTTGAGGAGACCACCTCGACCAGGTGCTATGAGCTTGAGGAG
ACCACCTCGACCATGTGCTATGTGCTTGAGCAGATCACCTCGACCAGGTG
CTATGTGCTT
back to top