FC930901

Overview
NameFC930901
Unique NameFC930901
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length600
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1830 contig Ccv1_Contig1830:15..614. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110C05EF PostHarvP1 Citrus clementina cDNA clone C34110C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930901 ID=FC930901|Name=FC930901|organism=Citrus clementina|type=EST|length=600bp
GATCCTTTTGCCAAATCGAAGACCCTGCTTGCTCTGCTTCGCTAGTTCTG
AGCTTAGAATCAGGAATAGAGGTGAAGATGAAATTTATAATGGAGTTTGC
TGAGAACATGATTCTGAGGTTGATGGAGGACCCGGAAGAGAGGGACAGGA
AATTCAGGGAGCGTTTGTATGAGAGGAAAGATAGGTGCCGTAAGACTAAA
GAGATGTGGAGCTATCCTCTGCGTCCCTACGGATTTTGGACATTTGAACG
TCACAATTCCCAACTCCGTTGGGATCCTCAGATTAGCCAAGTGCCTGGCA
GAAGGGACCCTTATGACGATCTTCTTCAGCACAGCTATGATGCCACCTCC
ACCTCCACCCCCACCTCCAATTGAATGCTAGAAAATTCAGAAGTGAAGGA
AGAATGATTCAAAACTTGTCAAAAGGGGAAGGTGAATTAAGCTGTTGTTA
TTATTATCATTTTTTTCTCTGGATTTGGTTGAACATTTTTATCAAAAATG
TCTGTTGGGTCGTAGTACCTCAGTGTTGCATACTATTAAGAGTCTGAATA
ATTGTCCATGTTACTCTGCTATTGTGGAATGACATATCTTTTGGCATGCA
back to top