FC930902

Overview
NameFC930902
Unique NameFC930902
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length758
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig5503 contig Ccv1_Contig5503:854..1612. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110C06EF PostHarvP1 Citrus clementina cDNA clone C34110C06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930902 ID=FC930902|Name=FC930902|organism=Citrus clementina|type=EST|length=758bp
CTCGCCGGGTAGGCAAGGGGAGCGCCCTTTTCCATTCAGCGTGGATAAGG
GTTTTGTCCGATCTCACAGGATGCAAAGAAAACATTACAGGGGTCTGTCT
AACCCCCAGTGTGTTCATGGGATTGAAGTTGTTCCGTCACCCAACCTCAT
GAATCTTGATGAGGAAGAGAGGAAGAGGTGGGTGGAGCTTACGGGCAGGG
ATTTAAACTTCTCCATCCCTACTGAAGCTAGTGAGTTTTGTTCATGGAGG
AATAGTCCAAACACGGAATTCGAGCTTGAACGCCCTCATCCTCTACTGAA
GAATGGCGTAAATCCCCACCCGAAAAGATTGCTTAATGGCACCAGCTTGA
ATCTGTCTACACAACCATTAGAACATAGCAATGGGAACAAAATGGACATT
TCACCTGTGTGTCACAAACGGAAGAAGGATAATTTCCTACGGGCGATTGA
TGGTGATTCTTGTTTGCCTCATAATTCACATTCTGAAAGGGTATTGGACA
CGAAACTCCAGATAGTTGAGCCACCATGGATTTATGAGTTTAGCGGAGTA
ATGAAGAGCGTCTTTGGGCCTGTCACGGCAGCAAAAACAATTTATGAAGA
CGATGAAGGGTTCTTGATCATCATCAGTTTGCCTTTTGCTGATCTTCAAG
GGTGAAAGTTACTTGGAGGAATACTCCTACACATGGGATTGTGAAGGTAT
CTTGTGTGAGCACACCCGCATGCCATGATTAGAGACAGATAGACATTTAG
CTACTGAT
back to top