FC930904

Overview
NameFC930904
Unique NameFC930904
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length735
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110C08EF PostHarvP1 Citrus clementina cDNA clone C34110C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930904 ID=FC930904|Name=FC930904|organism=Citrus clementina|type=EST|length=735bp
GGGGTCGAATTGCTCGTCAGTATTGCTCATGATGGAAGACCAAGAGGAAA
AGGGCAACGCTGAAAATGGGATTGGAAGGCAAAAGCAAGTCAAAGATGAG
TACTTGTTGCAGTTTTTGGATTCATTGGATGGGTATTTAACTCTATTAGA
TTCTTTATCTTCGACCCTTAGCCAGGGGTGGCTGGAATTGGCAAGCGCCA
GGCATGCAATGGGAGCTTCACGCATTAATGGCGCTTTGTTAGATCTTAAA
GTTCACGCCGCTGCTACTTCACTGAAAGTATCTGAACAAGATGTTGATTC
CATGGAGTCGCAACCTTGCTTTACTTTATGCAAATGGGCATCCTCTGATA
ATGGAGAACGTTCTTCCGGAGAAGAGAAATCTCTAAGTCCACAGCTACGA
CACCGGAACAATTCCCAGCTCTCTGAAGAGAAAGTCTCAACAAGGACTGG
AACTCCACTTATTCTTGTTGACCAACAGCAGCGGCAAAAATCATTGTCAG
TGTTCGGAGTACTGGTCTCCCCAAAGCTTCGATCTGCACAATTATCATTT
GAGAGAGCTCTGGAGACACTTGTAGAAATAGCAAATTTGCACACAACAAT
GCTTTCTATGTTTGAACAAGTCCACAAAGAATTAGAAAACACCGATGGAT
GATACAAGTTTCTTCCTTTTGGTTGGTTATTTTGCATCGGAAGAATGATT
GATTTCATTCAGCAAGTCCTCAGATAGCGACAGAT
back to top