FC930906

Overview
NameFC930906
Unique NameFC930906
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length713
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig2074 contig Ccv1_Contig2074:1..703. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110C10EF PostHarvP1 Citrus clementina cDNA clone C34110C10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930906 ID=FC930906|Name=FC930906|organism=Citrus clementina|type=EST|length=713bp
GGAGTGCGAACGAACGTCTGGGGCGTCAGATTGACAATCGAATTCTCTGG
TATCTGAATTGGGTCGGATTCATTTCGAGGTCATGGTAGTGAAATTGATG
CCTTTTTGTCCGAGCTTATCTCAGAAACCTTTACCCAAACAAGTACAAAT
CAGAACCCAAATGAAATACACAACAACGAGGAGGCCTGAGATTTTAACTT
CTTCTGCAGCTGCTTCTTCCACAAGTGCTTCTGGGTTAAGGGTCTTTGTG
CTTTCCGATTTGCACACTGATTACTCTGAGAACATGACTTGGGTCAAATG
CTTGTCCACTACAAGACACAAGAAAGATGTTCTTCTTGTTGCTGGTGATG
TTGCCGAGAAGTATGACGATTTCGTTTTGACTATGTCTCTTTTGAAAGAT
TGCTTTCAACGTGTCTTATTCGTGCCCGGAAACCATGATCTTTGGTGCCG
TGGGGAGGAAAATGATTTTCCTGATTCTCTTGAAAAGCTGAATAAATTGC
TTGATGCATGTAGAGGACTAGGAGTTGAGATCAATCCAGTGGTCATTGAT
GGCTTGGGAATCATTCCTCTGTTCTCTTGGTACCATGAGAGCTTTGATAG
AGAAAAGGATATAAGTGGCATCCGCATTCTGCCTTTGGAGATGGTGATTC
ACTTTCTTTTCTCCCTTGCAGACCTATGTCCAGAGAAAGAGATGCTATTT
TATCCGAATCTCC
back to top