FC931081

Overview
NameFC931081
Unique NameFC931081
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length713
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC931081_ssr210 microsatellite FC931081_ssr210:210..224. BLAST: Citrus ESTs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionC34101C01EF PostHarvP1 Citrus clementina cDNA clone C34101C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931081 ID=FC931081|Name=FC931081|organism=Citrus clementina|type=EST|length=713bp
GACGGTCAGTACTCCCCACATGCCTTTCTCCCACAAGTCCCGGCGACAGA
AGCCATCGCAAAACCCTGATTACTTATTACTCCAAAGCCATGAGCCTTCT
TCGAAACGCAATCAAATCGAGCGTTTCGCTTAGAACGATTAAGCCGATTC
ACAGCCTCCCGTCTCTTCTTCGTCAATCACCGAAACATTTCTCGACCGAA
ACAGAGGCACCGCCGCCGCCGCCGCCAAATGATGCGTCAATCGATCTGTT
TCTTCAAACACCAACTAAAGGTGTGTTTTATGGGAAATTGTTGGGCATAT
CAAGGCAAACACTGAAGAGTGATATAATCAACTTGCTTGAGGGCTGTAAT
TTGACGCCAGATGATCTCAAAGTCAACTACACCCGCAACTATATGCCCTT
TGCAATGATGATGCAATTCCCTTCTTTTAGTGCATATGATAATGCATTTA
GGCTTATTGGGAGAAAGGGCCGCTTGTACAGATTGGAAAGGGCTGAACAG
AGTGAATGGGATATTGTCATGCCCTATAATGGAAAAACTGTTTTACTGCA
AAATGTTCCTAGAATTGCTGTTGCAGAAGATGTAGAACGCTTTCTCTCAG
GCTGTGAATACGAGGCATCCTCCATCAGTTTTATGTTGAGGCAGTCACTC
CCAGATTCCATTAAATGGGCAACTGTTCGCTTCCCATCACAGACACAGGC
AATGGATGCATTC
back to top