FC931088

Overview
NameFC931088
Unique NameFC931088
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length743
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC34101C09EF PostHarvP1 Citrus clementina cDNA clone C34101C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931088 ID=FC931088|Name=FC931088|organism=Citrus clementina|type=EST|length=743bp
ATTCTTCCTATTAATTTTGTTTGATTTTCTGTGAAGTACTTCATGTATTT
CGCATGTGTATTTGTGGAGAGTTGATGCCATGTAAACGGTTGCACAATTG
ATGACAAGTTACTGCTTTCAGTTGGGGGATTTTGAAATTCTCCTCTCTAT
ATGATGAAATCTTCATTTGGTGACTGCCGTGCTTTATAGTATGTAATGCA
TATCCATGTCCTAATGGACTGAGTGAAAAATGGTAAAGTTCTTGAAGGGT
CCAAACGTTAATAATAAGTCTTTAGCTTGACAAGCATGTAGCTGTGCATT
CCTTTGGCAGCGGCGTGAAATGGATCAAGATCAGGCATTTTCATTACTGC
AGATGTCATGAAGGCGTGAAGCTGATCCTGTTTGATATTATCTTCAATAT
TCCCAGGTTTGCTAAAATAAAGCTTGTATGTTTAATATTGGTGGCAGTGC
AAGCATCAGAAGGAGCTGCCACCAGCTTTGAGGGAATGCTTTTGAGCCCT
TTGATTCATTACAGAAAAGCTTATTGTCATGAAATGTTAAGTTACCTTGA
AGCACAGAAGCCAACAATGTAGTCTGCGGCGGAACATGTTATGATACTTG
TACGGTCATCAAACGCATAGCTGGATGCTGCAGGGCAAACTTGCTTGAAG
CTCTTGGAATAGTTTGAAGCCAAGCATGAGCCAGATCTGAGGGGCAGTTT
TGCCCTCAATCTCCATCACAACCAGCATTGCTGCAATTCCCTT
back to top