FC931089

Overview
NameFC931089
Unique NameFC931089
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length705
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34101C10EF PostHarvP1 Citrus clementina cDNA clone C34101C10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931089 ID=FC931089|Name=FC931089|organism=Citrus clementina|type=EST|length=705bp
ATTTGCCTTTTATCGGTGTTTGTCAAGTTAAGGATGAATGCTTGGAGTGG
GGTACTTGGTAACATTTCTGCCTCAGATGAATCCCTGAAGAAATGCCTAC
GGTTCCTGAGACCAAATACAGGGAGAAGAAGTGGTCAGTTTCAATCCGGA
ATTGGAATATGGCAATTTGGTTCAAGCACACACACCCGGTCACTTGAACA
CCAATATTTGCCAGAGATTTAGAGAAGCATATCAAGCTGCTTGGCAAACT
TGACAAACTTCAAGATCCTCCATTCTTCACAACGCAAAACTTGGTAGTTG
GATGCTGTATACTCGAAAAGCGACCAACATCAAGAACTATGACTCCAAGA
CCGGGTTTGCATTAATTCAATCAGCTGAAATCATGATGCAAATGACACTA
TCAGCTGGACTTAGAGACCGGTCAGATCAATCATCCATTTTATCAACAGT
TAATGTCATGATGGTGGCTATTAGAGGAAACAAAGGATGTGTTGGAATCA
ATGTGAACAATGAGAAGAATGAGAGGAGCTTTGATTATACGTAGGTTCAA
TGAACTCATGCTGGTTGATCTGTTGAAGAACAAGCTTGGGTTGATTATGC
TTTAACTACAAGGAAGTGCCAGACTTGGATGCAGGCGTTCAGCTTTTAAT
GGATGCTTTTGAGAAGGTAAAACACAGCATTTCAAAAATGCTGGGGTAAG
ATGCA
back to top