FC931097

Overview
NameFC931097
Unique NameFC931097
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length311
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34101D07EF PostHarvP1 Citrus clementina cDNA clone C34101D07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931097 ID=FC931097|Name=FC931097|organism=Citrus clementina|type=EST|length=311bp
GAGTCGAGCGATGGTTCTGGGCATGGAATCGCGGGGTTTTTTTTCCAGCG
AATTTGAATGGCAAGCCGACCAACCTTTGTCTGCGGCCCGGTTCCCTAAC
TCATGAATACCACTCTCTGTGACGCACATGACTGCTCGGGGACTGGGGTA
TTCGAAATTTGCCAAAAGTCGAAAAAACGGAGTCGATTGGGATGAATGGT
TCAACATAGCTGGCCGTTGACTCGCGCCGTGGCGGTTTAATCCAAAGAGA
CAATTTTCAAGAGTTCAACATTATTCTTATGATCAAAAAAAAAAAAAAAA
AAAAAAAAAAA
back to top