FC931151

Overview
NameFC931151
Unique NameFC931151
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length737
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC931151_ssr213 microsatellite FC931151_ssr213:213..224. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102A07EF PostHarvP1 Citrus clementina cDNA clone C34102A07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931151 ID=FC931151|Name=FC931151|organism=Citrus clementina|type=EST|length=737bp
GGTTTATGTGTTATGAGAAAAATAATACATAACCAACGGAAGAAGAGAGG
GGAGGTTTTGGATCAAAATACAAGTCAAAGTTATGGCTGAAGTTGGCGAA
TGCTCTGCGTCTAAACCCTCTCGTGAAATCTGGGCAAAGCTTGAACCATC
AGACTCAAGGTTTGCCGATGTTGACATAAGCTCAAATGAGGTGGTTATAT
GCTCAGAGATCACTTCTTCTTCTTCTGACAAACATGAATGGTGCAAAATT
ACTAGGAATTCTGATCTACATTCAGCTAAGATGCAAAATAAAAGTTCAAA
TGCTATACTTGTCGATGATACCATGGTCCAAAATGAAGAGGTCGTTGACA
TTAAGTGTGGAACTGAAATTATTCCTGGCCCTGATAGAGAAGTATATTTG
AACTTCAGATTTAAAGTAGTACCTGTACAAGAATCCAGCAATCAGCAATT
GGAGATTTCCATTGACATCGAGCATGCAAAATGCTGCATCTGCTTGAATA
TATGGCATGATGTTGTTACAGTTGCTCCTTGCCTTCATAATTTCTGCAAT
GGATGCTTCTCTGAGTGGTTAAGACGATCACAGGAAAAACGTTCGACTGT
ACTTTGTCCGCATTGTAGAGCAGTTGTACAATTTGTTGGAAGAACCATTA
TTTGCATAATATTGAGCAGAGTATACTACAAGCTCATTCTTCACTTAGGC
GTTCTGATGAAGAAAAGTGCACTTCTGATTCCTATGC
back to top