FC931152

Overview
NameFC931152
Unique NameFC931152
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length698
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11131 contig Ccv1_Contig11131:24..728. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102A08EF PostHarvP1 Citrus clementina cDNA clone C34102A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931152 ID=FC931152|Name=FC931152|organism=Citrus clementina|type=EST|length=698bp
GATATTATAATTTTCCTCTCACCAATTTTGCATATCTTCGGATTCTGAAA
AAAAGAAAAAAGAAAAAAGAATTGATTCTTCAAAAATCAATCCAACAAAC
CCAAAAATGGCGAACAATCACAACAATGATACCGGCAGCGGCAACGATTC
TGAATCGAGCCCTCTGTTGACCAATCACCACGTGGCAGCAGATGCCGAGG
ACGAGAAGAAGTCAAATATTGACGGCAAGACCAACGGCGTTAAGGTTCCG
CCAGGTGGGAAATCCGAGGCGCCGGCGTCGGCTGGGTACGATTGGACGGC
GAATGGGCTGCCGTTGGGTCACGGGAGTGTGATGGGCGAGCCGATGGGAC
GGAGCCTGTGGGACTCGAGTCTCTTCGCTTGCCTCGGTCGCAATGATGAG
TTTTGCAGCAGCGATCTTGAAGTTTGTCTTCTTGGAGGCATGGCACCATG
TGTTCTGTATGGAAGCAATGTTGAGAGGCTTGCATCTGCTCCAGGAACCT
TTGCAAATCACTGCCTGCCTTACTCTGGTCTGTACCTGATTGGTAATGCC
TTTTTTGGTTGGAATTGCCTTGCACCATGGTTTTCATATCCTAGCCGTAC
TGCTATCCGCCGAAAGTTTAATCTGGAGGGAAGCTTTGAGGCACTTAATA
GGTCATGTGGATGTTGTGGAAGTTGCGTGGAAGATGAGTTGCAACGTG
back to top