FC931166

Overview
NameFC931166
Unique NameFC931166
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length117
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig454 contig Ccv1_Contig454:318..433. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102B10EF PostHarvP1 Citrus clementina cDNA clone C34102B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931166 ID=FC931166|Name=FC931166|organism=Citrus clementina|type=EST|length=117bp
CCCCTCTTCACCAGCTGATGAGATTGCCCCCCCATTATTTTGCGACACGA
TGTTCCCACGTGTGATCCACATGTGATCTCTAAAATTAAACATTTTTAAT
CTAAATGATTCTTATTG
back to top