FC931170

Overview
NameFC931170
Unique NameFC931170
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length694
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34102C02EF PostHarvP1 Citrus clementina cDNA clone C34102C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931170 ID=FC931170|Name=FC931170|organism=Citrus clementina|type=EST|length=694bp
CTGGATGGCGCTGTGCCTTCATTTTGATGGCTACATTGAGTGTGCTGATT
GCATTCCTTGTACTCGTATTTGTTGTTGACCCAAGGAAAAAAGCTAGCAC
CTTTCATGGTACTGGTGAAAATTTTGACAGAGATGAACTAGTAGAAAAGG
GCAATACAAGTGTATCATCTGTTTGGCTGGAGTCTTGGATGGCCACAAAA
GCCGTCATCAAAGTGCCAACATTTCAGATAATTGTCTTGCAGGGCATTGT
TGGTTCACTGCCATGGACTGCCATGGTATTCTTTACCATGTGGTTTGAAT
TAATTGGTTTTGATCATAGTAGTACGGCAGCCCTTTTAAGTCTTTTTGCC
ATTGGATGTGCTGTGGGGTCCTTCCTTGGTGGAGTAGTAGCAGATCGAAT
ATCACAAGCCTATCCCCACAGTGGCCGTGTTATGTGTGCTCAGTTCAGTG
CCTTCATGGGCATACCATTCTCATGGTTCCTTCTCACAGCGATTCCACAA
TCTGTTAGCAACTATTACACTTATGCTGTCACCCTTGTTCTAATGGGCTT
AACCATCAGCTGGAATGCCACTGCTGCAAATGGCCCCATGTTTGCTGAGG
TAGTCCCTGCCAAACACCGGACCATGATTTATGCATTTGACCGTGCTTTT
GAAGGTTCGTTCTCTTCTTTTGCCGCCCCCTTGGTTGGAATTCT
back to top