FC931237

Overview
NameFC931237
Unique NameFC931237
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length412
Libraries
Library NameType
PostHarvP1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9703 contig Ccv1_Contig9703:188..601. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34103A04EF PostHarvP1 Citrus clementina cDNA clone C34103A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931237 ID=FC931237|Name=FC931237|organism=Citrus clementina|type=EST|length=412bp
ACTTGAGCTTTGTCAGCACCGTTGTTGTCATGGACGTTCAGGCTGCTGAG
ACTGAAGGTAACTGCAAGTGCGGCCCCACCTGCGCTTGTGTGAACTGCAC
TTGTGGTAGTCACTAATAAGCAAACACATGCAGCAAAAAATAAGAAGCTG
CAAGTGTGCCTAAATATTGTGGGGGTTAAGAATAATGTAAGGGTGATTAA
AAAAAAAGAAAAATTCTCTACTTCGTTTTTATGATGGTCTACTACTAGTG
TGTGGAGTGATGTGCGTGTTGTGTCACCCATCACTCGTAATGTTTTGTGT
TTCCTTCTTCATAATCATGTAATATATGGCCATGGCCATGACCGTGGCCT
TGTGTGGTTTAATTTTAATGTATTATTGTTAGTCCAAAAAAAAAAAAAAA
AAAAAAAAAAAA
back to top