FC931401

Overview
NameFC931401
Unique NameFC931401
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4822 contig Ccv1_Contig4822:90..811. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34104G02EF PostHarvP1 Citrus clementina cDNA clone C34104G02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931401 ID=FC931401|Name=FC931401|organism=Citrus clementina|type=EST|length=722bp
GACACAATTTGTTTGTTCTTCGAATCAGATTTTGTGATCAGATGGCGGAA
GGCGGAGGGCATTCTCGGTATGTGAAGTTGACGAAGGAGCAGACTCCAGT
GGAGGATGACATCAAGCCCGGTGAGCTCAACCAGCCCATTGAGGTTCCTC
AGTTGAATGTTCATAGGTGCAATGAGTGTGGACAGCCTTTGCCTGAAGAT
TTTGAGCCTCCTGCTGATGAACCTTGGACTACTGGAATCTTCGGCTGTAC
TGAAGATACAGAAAGTTGCTGGACTGGACTCTTCTGCCCGTGTGTTCTAT
TTGGACGTAATGTGGAAAAGATGAGAGAAGATACCCCATGGACTCATCCT
TGCATTTGTCATGCCGTTTGCATTGAAGGTGGCGTAGCTTTGGCAGCAGC
AACAGCTGTTTTTCATGGTATTGACCCCAGGACATCATTTCTTATTTGTG
AGGGTTTGTTTTTTGCTTGGTGGATGTGTGGGATATACACTGGAAACTTA
CGGCAAAACTTACAGAAGAAATATCATCTCAAGAACTCGCCGTGTGAGCC
GTGCCTGGTAAACTGCTGCCTGCACTGGTGTGCATTGTGCCAGGAGCACA
GGGAGATGAAGAACCGCCTCTCAGAATATGTTGCAATGCCAATGACTGTT
GTCAACCCTCCCCCTGTTCAAGAGATGAACTCTGCCCCTGAAAACCAGGA
TCCTGCTCCATCCTCTGGGAAT
back to top