FC931436

Overview
NameFC931436
Unique NameFC931436
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length601
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15069 contig Ccv1_Contig15069:2..602. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34105B01EF PostHarvP1 Citrus clementina cDNA clone C34105B01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931436 ID=FC931436; Name=FC931436; organism=Citrus clementina; type=EST; length=601bp
GGATCATCTAAGATCATATCATTCTTACAAAAGCGAGTCAGCTGTCAACT
GCAGGAAGCTTGACTTTCAAAGAGTGTGAATTCGGGTTTTTTAACGAGAA
TTTTAGCTACAATGAATCCGGCACGAGTCACTTTTATGGCAGCCACTGTT
TGCGTGATGCTTACCACGCATTTCTCGACACAGCTTCTCTCAGAACACTT
TCTTTCCTGGAAAAAGCCAAAGGAGCAAAAAGCTATAATAATTATCATTC
TTATGGCACCTATATATGCAATTGACTCTTATGTTGGTTTGATAGATTTT
CAGGGGAGCAAGGCCTTTTTTATGTTCTTGGAATCAGTTAAGGAATGTTA
TGAGGCCTTGGTGATAGCCAAGTTCTTGGCCTTGCTGTACAGCTACTTGA
ATATATCAATAAGCAAAAACATAGTGCCAGATGAGATCAAAGGAAGGGAT
ATTCACCATTCATTTCCAATGACTCTTTTTCAGCCTCGGACAGCTCGTTT
GAACCATCATACACTAAAGCTTCTCAAGGACTGGACGTGGCAGTTTGTTG
TGATCCGCCCTGTCTGCTCCATATTGATGATTGCTCTTCAACTTCTTGGG
T
back to top