FC931781

Overview
NameFC931781
Unique NameFC931781
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length688
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9425 contig Ccv1_Contig9425:516..1203. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarveNcdna_library
Properties
Property NameValue
Genbank descriptionC34201B05EF PostHarveN Citrus clementina cDNA clone C34201B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931781 ID=FC931781|Name=FC931781|organism=Citrus clementina|type=EST|length=688bp
GGAACAGCAACGCATATTCCACATCCTTATGGTATAGAAATTGGCAATCC
TGCTACAATTCCTGCAGGCTATGAAGAGAGATGGTTTCTTAATGTCCATG
CAATTGATACACGAGGTGTCGAAGATAGGTTGGGATGCACCGAATGCAAG
TGCGATTTGTACAATGTTACAGTGGATGAGTATGGCCAGCCGCTAAGGCC
AAATTACAGAGGTGGTTTTGCGTGTTGTTACGATGGTACTCAGTGTAGAG
TGAAAAATGGTTTTGAAGGTGCCAGGAGGAGCCTCTATTTGAGATATACC
GTAAAGTGGGTTGATTGGGACACTTCCATTGTGCCTGTTAAAATCTACAT
ATTTGATGTCACTGACAATGAAACATGGTTTAGTGATTCCACTGGATTCA
GCATACAGCATCATTGCCAGACTGAATATTCTGTTGATCCCTGTAAAGCC
AATGATGTAGCTGATAATGGGTGTGTCCACACCAAAAGGACCAGTGTCAC
GATGCCAACCAGTGGTTACATCATCTATGGCGTTGCCCATCAGCACTCAG
GGGGCATTGGTGCAGCTCTATACAGAGAGGATGGACAACTTATGTGCTCT
TCAATTCCAGCTTATGGAAATGGGATGGAAGCTGGAAACGAGGCTGGATA
TATTGTAGGAATGTCGACCTGTTATCCTAACCAGGCTC
back to top