BG732304

Overview
NameBG732304
Unique NameBG732304
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length182
Alignments
Feature NameTypeLocationAnalysis
BG732304_ssr81 microsatellite BG732304_ssr81:81..90.
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-4c Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-4c, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732304 ID=BG732304|Name=BG732304|organism=Citrus sinensis|type=EST|length=182bp
CGAAACATTAACAACATCAGCAGTAGTAGCAGCAGCAGTAGCAGTAGCAG
GAGCAGCATTGTTATTTTGCTTGATAGTCATCTCTCTCTCAGCAGCAGTT
TCCTTAAATTATTGACCCTCCTCTCATATCTTCAGCAACCAGCATAGCAA
TATCAGCCATGTCTCTTTGAATCATACTTTTC
back to top