BG732308

Overview
NameBG732308
Unique NameBG732308
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length230
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9132 contig Csv1_Contig9132:34..263. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-8b Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-8b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732308 ID=BG732308|Name=BG732308|organism=Citrus sinensis|type=EST|length=230bp
CAGTGAGCGTCGTGGCCTTATGTGGAAGACAAATCCTACCTTTTGACTTG
GCTATTTCTGATTCCATTAGGGGCTTACACCCTCTGGCAGGTTCTTTATT
TTCTCATTGTCAATGTACTACGTCGACAAAGGCTGGTAAGGGATCCTGAA
GTCATGACCTCTTACAGGTTCTCAACTCCCTCTTAACTTTTCTACCCACA
TAAGATCTGTTGTATTAATACAGCTGCTTC
back to top