BG732316

Overview
NameBG732316
Unique NameBG732316
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length231
Libraries
Library NameType
Citrus sinensis flavedo cellscdna_library
Properties
Property NameValue
Genbank descriptionCs-12a Citrus sinensis flavedo cells Citrus sinensis cDNA clone Cs-12a, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BG732316 ID=BG732316|Name=BG732316|organism=Citrus sinensis|type=EST|length=231bp
CGAGAAGCAATGGGAACGACGGAACCCGCGAATAAAGAAAAAGAAGATTC
TATTGGAAATGAATCTTAATGATTTATTGGGTGGGATGGCGAAACGAACC
CAGGAACTAAACTATTCTTTTATTCGTAGAGGTCATGAACTAACCCTACA
ACTGAAATAGATATTGAAAGAGTAAATATTCGCCCGCGAAAGGTTTATTT
TTTGATTTTATTGGATTGATTCATTTTGCTC
back to top