BQ622936

Overview
NameBQ622936
Unique NameBQ622936
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length688
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1909 contig Csv1_Contig1909:473..1160. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00027 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00027 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622936 ID=BQ622936|Name=BQ622936|organism=Citrus sinensis|type=EST|length=688bp
CACATTCACAGATTATAGAGTGAAGGTGATGCTTGATCGCAATGTTTACT
TGGTAGATACTGTGAGGGAAAGAATTGGTAGGGTTTTGAAATTAGACTCA
ATTCAAGGTGGTAAGCTCTGGAAAGGAATTGATATGCTCATCTTCAACAC
TTGGCATTGGTGGAACCGCAGAGGACCCACTCAGCCATGGGATTTTATAA
AAATTGGAAATAAAACTCTAAAAGACATGGATCGCATGATTGCTTTCGAG
AAGGCACTAACAACATGGGGACATTGGGTGGATGCAAATATCAATACTTC
AAAATCCATGGTCTTTTTCCAAGGAATTTCTCCTTCTCATTACAATGGCA
CCGAGTGGCATGAACCGAGTGCAAAGAGCTGTATCCGGCAGAGAGAACCG
GTGTTGGGATCAACATATCCGGGAGGCCTGCCGCCGGCGGTGGGGGTGCT
GAAGAAAGCGCTAAGAAAGATTAAAAAACCAGTGAAGTTACTAGACATAA
CAAACCTCTCATTGCTCCGTAAAGATGGGCATCCTTCGATGTATGGCCTT
GGCGGACCCACAGGAATGGACTGTAGCCATTGGTGCCTTGCTGGTGTTCC
AGATACCTGGAACGAGATTCTTTACAATATGGGTCTTTGATCATTATTCA
TTTTATTATTACTATTATATTGGGTAATTTAGTGACAT
back to top