BQ622944

Overview
NameBQ622944
Unique NameBQ622944
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length524
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00035 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00035 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622944 ID=BQ622944|Name=BQ622944|organism=Citrus sinensis|type=EST|length=524bp
CTCTGTATCGACGACTTCCGTGGCTGGCCTGGGTTTCGCGATAAATTCAA
GGACATTCCGATGGTAAACGGCAACGTTTTACTTTATTTCCAGTTCCTGC
AGAATGTCATTTACCAAAACGCCATCGATTCGGTTTTGCCCGTGCCGTTT
TCCAGCGGCTCGGCTTTAACCAAACTTTGTGAGTGGGGAGTGGTGGGTGA
TTTGATAGAAATTGACGCGGGCCATGACTTTAACTCGGCCTGGGCGGATA
TCAACCGGGCTTGGCGGATCTTGAGACCCGGTGGGGTAATTTTTGGCCAC
GATTATTTTACTGCTGCGGATAACAGAGGCGTAAGGAGAGCGGTAAATTT
GTTTGCTAAGATTAACGGTCTGAAAGTTCAAATTGATGGGCAGCACTGGG
TCATCCACTCTGCTGTTAATGCTTAGATTTTTTTTCACATATGTATCTCG
TGTATACCTGGCATCTCCCGTCCCGTCATGTGATCTCAAAATTACCCCCC
CCACAAAAAAAGGGGTGCTTGATC
back to top