BQ623036

Overview
NameBQ623036
Unique NameBQ623036
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length400
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5019 contig Csv1_Contig5019:276..675. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00127 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00127 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623036 ID=BQ623036|Name=BQ623036|organism=Citrus sinensis|type=EST|length=400bp
GAAGTTTTGTATACGGTTCACCAGAAGTTTGAAGATATCTTTTCTAATTT
GAAGAATATGGAAACTCCTTATCCAGGTAAGAACGAATGGTCTGAGGGTA
ACCCAATAACTATGTACAGCATTATTGATGATGAGAGCGTGAATGACAAT
CTGGATCTTATTGTCGTCCCTCAATACGGAAGAAATCTCGATCACACTGG
TTAAGTGCTATCTTACTCTTTCGAATTATGTTCAATTAAATAAAATGATG
GGTTATTAATACCTGTCAATTATGTGAGTGTCTCTGTTTGTTTTAGTTCA
ACTTATAAAATCTCTTGAGATATACAAGAGATTTTCTTTATTTACTTCTG
TGTATCGTGTCTTCTTGAAAAAAGAAATTAATAAAAAATATCATTGTGTG
back to top