BQ623086

Overview
NameBQ623086
Unique NameBQ623086
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length318
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00177 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00177 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623086 ID=BQ623086|Name=BQ623086|organism=Citrus sinensis|type=EST|length=318bp
TCAGCCCAGCCTTTTCCCCAGTCTAAGAATGTGGAATAAGACTTAGATGT
GCTCGCTGCGAGCAGCATATCTGCTTCAGGAAAAGCGTTGAAACTTTGCT
CCTTGCCTGATTTGAGAAACTCTAGTCCACGTGTCGTTGGTTCTAGGAAT
TTAATCTGAACATGTGTCTGCATAGAAACAGTGTACCTGAGCAGATTGGC
CGAAGAAGAAACACATGCAGTTAAGAGAAGACGGACATGTATATATGTAT
TTTTTCAACTGCATACCCTGTCATCTCCTTCTCTTATATAACCTTTATTT
TCCATTAAAAAAAAAAAA
back to top