BQ623096

Overview
NameBQ623096
Unique NameBQ623096
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length678
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11941 contig Csv1_Contig11941:15..691. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00187 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00187 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623096 ID=BQ623096|Name=BQ623096|organism=Citrus sinensis|type=EST|length=678bp
ATTTCGATCTATTTGTCTGCAAATCTTCTCATAGTTATATCACCAAAGGA
AAACGAAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAGCTA
GCAAGTGCGGCGGCGGCTGCGGCGGTAGCCTCCATGTACCCTGACTTGAG
ATCCTTTGAGAGCACCACCGTAGCCACCGAGACCCTCGTCCTCGGTGTTG
CTCCTGTCAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGAG
GGCGGCTGCGGCTGCAAGTGTGGACCAAACTGCAAGTGCGACCCTTGTAA
CTGTTAATGAAGACTACGAGACGTGAACATGCCCCAGAATAAAGCAGCGC
TGTGAGGTCGTTTAAATTATAGTATCAATAAAAAGAACTATTTATCGTTT
GTGGTTGGCTTTGTTGGATGTCGTTTTATGAGCTTTTGTTTGTAAAATAA
AAACCAGCCATGGCTGCTTCTCCGAATCCTTAACTGGGTCTGTTGCAGAT
CCATGGCTAGTTAATTAATCATTAAGTGTCTCTGTGACTTTGTGTACGAG
CGTATCTGTTACTGCTGCTATTCTAATGGGAAGCTTCCTCTCAGACTTTT
ATCTATATTGTAAAATGTGTTTGGTTTATGTACTGATAATAAATTTACAA
CGTTGATTTAAAAAAAAAAAAAAAAAAA
back to top