BQ623192

Overview
NameBQ623192
Unique NameBQ623192
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length620
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1848 contig Csv1_Contig1848:21..639. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_00283 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00283 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623192 ID=BQ623192|Name=BQ623192|organism=Citrus sinensis|type=EST|length=620bp
GGGTGCTAAGAGCAACAAAACTAAATTCTGAAGCAATTGTTCTGACTCTT
GAGTGCTTATATTTATTTCATTAATCTCGGAAGATATGGCGTCTCATAAG
GTGCCTGGTAATCGCAAATTGATAGGTGCCAAATCAGAATACTATTTTAT
GCTTTATGCAGGTACTGAAGAAGTGAAGAGCTACGACCGGATTGATTTTG
GTATGTTTGGTCGGAGTTGGGCTCCCATTGTTTCTTGGGCCGTGATAGTG
GTTCCCCACGAGCCGGAGAGTAATTGGAGAAAAAATTTACCTCCTCCAAG
TGTCAATAATATGGACCCCGCTAGCTCGCTTTGTGTCATTGCATCTGGTT
CTTCTAATGGTTATAAGCCTATAGGTGATGATAAACATGATCGTCCTTTT
CATGGCGTTAGAACTACAGTTCGATTGAACAAATTGAAATATGATCGTGA
AGTGTTGCGCGGAGGTTCTCTTGTTTTGGAGATTAATCTTCTAGAGGTTT
TTTCCGGAGGAGATGTTGTGGATTCTGATCATACTTTTGATGGGTCAAGT
GTTCTGGAACTTGTACTCGAATTGAATATTGTACGGTGAGATAAGATGAT
GTGTGAATAATGGCATCATC
back to top