BQ623248

Overview
NameBQ623248
Unique NameBQ623248
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length277
Alignments
Feature NameTypeLocationAnalysis
BQ623248_ssr248 microsatellite BQ623248_ssr248:248..259.
Csv1_Contig6135 contig Csv1_Contig6135:521..797. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00339 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00339 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623248 ID=BQ623248|Name=BQ623248|organism=Citrus sinensis|type=EST|length=277bp
GGGTGTTGTTCAGTCTGTGGTGGTTACCTTTCTAGTGAATAACTTGTTTT
ACTAGAAGGGCTTAGGCTTTGTTTGCCCCAAACAGGCTATTAGTCGCGTT
TGTTCTTTTTTTATTTTGACTTTGTGCTACGTACATTCAGCACAATAATT
GAAGTTATTATTTTAGAGGGGCGGAGTGGAGAGTTATATTTGTATTTTAC
ATTTAATCTTGATGGATCTGCTTCCCGTCTGATTTGTTGTAATAGCCATA
AATAAATAAACAGCGACTTATTGTTCT
back to top