BQ623253

Overview
NameBQ623253
Unique NameBQ623253
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length626
Alignments
Feature NameTypeLocationAnalysis
BQ623253_ssr366 microsatellite BQ623253_ssr366:366..389.
Csv1_Contig12076 contig Csv1_Contig12076:51..675. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00344 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00344 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623253 ID=BQ623253|Name=BQ623253|organism=Citrus sinensis|type=EST|length=626bp
CATAAATAGCAATTAGCTTGAGCAACAACAATGGCTTTATCCAAGACTTT
CCTCCTTCTTGGCCTTGCATTGGCTCTTGTTCTTCTCATTTCCTCTGAGG
TCTCATCAGCTCGCGAGCTTGCTGAAGCAACCCACACCCAGAGTGTGGAG
GACAGGACAAGATTAACCAAGCACGAAACTGATAATTATGGGTACGGACA
CGGATATGGCCATGGACATAAATATGGCCATGGCAAGGGGTACGGACACG
GTGGATATGGACATTACGGCAAGCCTGGCCATGGAGGTCATCCCGGACAC
GGTGCTGATGGAGTTGAAACCGAAGATGGAGGGAACTAAATAAACCCTTG
CTAACCTAGCTAAGCCTTCTTCTTCTTCTTCTTCTTCTTCCTTGTTGGCT
AAGCTAGGTCTTTTATGAATGTGTTGCTTGCTGAAATAAATAACTAAGCT
TTAGTTTATTGAATGTTTTCTTGTCAGCAAGAGTGTGTAAGTAAGGCTCG
ATATTGAGATGTGGCCATGAATGTTCTTTTATAAGGCACCATGGTTACGT
TGATATTGATCGGGTAATTTGTACTACTATAAAATATATAAGTGTTTTAC
TTCTAAAAAAAAAAAAAAAAAAAAAA
back to top