BQ623345

Overview
NameBQ623345
Unique NameBQ623345
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length568
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig19 contig Csv1_Contig19:1..568. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00436 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00436 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623345 ID=BQ623345|Name=BQ623345|organism=Citrus sinensis|type=EST|length=568bp
ATGAGAGGAAACAGTGCTGACACAGCAAGGCACGTTATGTGCCCATCTCC
AAACAAAAGAATCAGCATCACATTCTTCAGAGTCCGACCTGAGTCCAACC
AGAGCCAGTCTCCACCAACTACTCCAACTGGTACTATGAACGGCGCAATG
GCTCTGTGGCAACCAGGTGTCCCAAGTCCATATTCAGTGCCCAATGGCGC
TCCAAGTGGCTATGAAGCAATGGATATGACGCCCAAATGGGGAGTACTTC
GTGCCCCTGTGGTCATGTTAGCTCCAGTGCGTCCTATGGCTTTGAGCCCT
GGAAGAATGCCTCATGGTGGTACGGGGGTTTTCTTGCCCTGGGCTGTGGG
ATCAAGAAAACCTGCCAAGCATCTTCCGCCTCGTGCTCAGAAAGGACGAT
TTCTTGCACTACCTTCCTCAGTTGTAGCAGAGTCTGCTCCTGAATCTGCC
GTCAGCGTTGAAGCTAAAGAGGGATGAAGTTAGCTCCAGAAAGCCCTGAG
GCTGCGGCATGTGCGAAGAAAGTATCGTGCTTGTTCAATTCACACTCTTA
AGAAGCATCTCTATTGAC
back to top