BQ623589

Overview
NameBQ623589
Unique NameBQ623589
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length483
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7805 contig Csv1_Contig7805:414..896. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00680 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00680 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623589 ID=BQ623589|Name=BQ623589|organism=Citrus sinensis|type=EST|length=483bp
ATACAAGCCCTACCACTGCTTCTTCTCAGCAGCAGAATGAAGAGCCAAAT
TTTTTCCACAAGGCAACAACAGCAGCAGTGCGGCCTTGGCCTGCAGCTCC
AATGGACTATTTCAACTCAGGACTACTAGGGCCATCTTCGTCTCGGCCAC
CACATCATCATCTTTCGGGGCAAATCCAATTGGGAAGCTCAAATTCTCTC
CCACAAGCAATGCAAATCCCACCATTCAGTGTAACCAATGAAAACCACCA
TCAAGAAATGCAACATTTTTCATTTGTTCATGACCATTTAATCCCAGTAA
CAGCCACCCAACCGGGGCCTGGCGGGGGCGATTACTTCACAATCTCTTCC
AGCCTTGGTTTCAATAGGGGGACCCTTCAGTCCAATTCATCACCGTCTGT
TTTCCCTCACATTCAGAGGTTTGGTTCTTCTTCTCCTATAGACGGATCCA
ATATTAATGTACCTTTCTTAATCGGTACTGCAC
back to top