BQ623591

Overview
NameBQ623591
Unique NameBQ623591
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length612
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
BQ623591_ssr556 microsatellite BQ623591_ssr556:556..573. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2304 contig Csv1_Contig2304:169..780. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00682 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00682 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623591 ID=BQ623591|Name=BQ623591|organism=Citrus sinensis|type=EST|length=612bp
CACCATCCTCATCGTGTGGGCCATCCTCCGCCCTACGAAACCTAGGTTCA
TCCTCCAAGACGCCACCGTTTACGTCTTCAACGTCTCGAACCCGAACGTC
CTCACGTCAAGCTTCCAAGTCACAATTTCCTCCCGAAACCCTAATGACAG
AATCGGTATTTACTACGACAAGCTTGACCTTTACGCCACTTACCATAGCC
AACAAATCACTTACAAGACCTCCCTTCCTACCACTTATCAAGGCCACAAG
GAGATCAACGTTTGGTCGCCGTACGTTTACGGTAACGCCGTCCCCGTGGC
CCCGTACAATGCTGTGTCCTTGACTCAAGATCAGTCTAGTGGGATCATCC
CTTTGATGTTCAAGATTGATGGACGGGTCAGATGGAAAGTCGGCACCTTC
ATTACCGGCAAGTATCATTTGTACGTCAGGTGTTCTGCGTATATAAATTT
TGGTGACAGGCAGGCCGGGACCGCCGTCGGTAATAACGCCGTCAAGTACC
AGCTTGTGCAGTCTTGCAGCGTTAGTGTGTGATGAAGCTGAAGATAGAAC
TAGAAGATGATGATGATGATGATGGACATGGGTGACGCCGTTAAAAGTAT
TTTAAATTTATC
back to top