BQ623602

Overview
NameBQ623602
Unique NameBQ623602
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length370
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3372 contig Csv1_Contig3372:536..905. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00693 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00693 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623602 ID=BQ623602|Name=BQ623602|organism=Citrus sinensis|type=EST|length=370bp
TTCTCTCCTTGCTAAAGTTTTCATCCTCAGCATTCTGCTTGCAATAGCCG
GGCAAGCATTGGCTGGACGTGGCAACCTGAAAGTAGCCAGGAGTGAAGAC
ATGAAACAGCCTGAGTGGCTGCTTAAGTCCGATCACAGTCTGCTCATTCC
TGGAATTGGGAGGGTGCTATGGCCACCAGGTTTCGGAACAGCTCACAGTC
CATACACTGGCAGCACTGGAGGAACAGGAGCAAGTGGCGGTCATATTCCA
GGTGGCGATGATACGTTTGACCCGAACCCTGGCACTGAGGTTCCAGGTCC
TGGCAGCGTAGGCAGTGTTCCTGGAAATTAATGCTCTCACCGTTAAGCTT
CTTCGAGCTGTTTTGTCAAT
back to top